The following article is from the brilliant publication The Greyhound Bible, which was published in 2004.
Every time you breed a litter you.re embarking on a journey into the unknown and taking part in the lottery of life itself. This journey maybe pleasurable, even indulgent, but one thing is certain, it will be expensive. Failure is a subjective thing - some will judge it a success just getting a dog to qualify in bottom grade at Mildenhall, but others will deem it failure not to get top grade dogs running at our premier tracks. One thing is certain though, the slow ones will greatly out number the fast ones.
Why can a bottom grade bitch produce a champion racer who goes onto be a successful sire? Why can a Derby winner, bred in the purple, be such a flop at stud? I would be a rich man if could answer such questions and spot these examples in advance - but I'm not and can't. The answer, in part, can be explained through the bewildering science of genetics. The following article only scratches the surface, but if there's one piece in this book you read more than once, make it this one.
Schoolboy Biology
The human body is made up of one trillion cells. That.s 100,000,000,000,000 cells! But we didn.t start out that way. We each began as one single cell. Cells reproduce themselves by dividing. A mother cell divides into two .daughter. cells that are identical to the mother cell.
After growing for a while, these two cells divide to make four cells. If cell division continues, eventually there will be a trillion cells. Cells don.t just split in half, though. Before they can divide, cells must make some preparations.
Most human cells are diploid. which means they have two complete sets of 23 chromosomes. Before it divides, the mother cell makes a copy of each chromosome. This means that, for a short time, it has FOUR complete sets of 23 chromosomes. This means that when it divides, each daughter cell receives TWO sets of chromosomes - this is called mitosis. Through mitosis we can keep dividing - from one cell all the way to a trillion.
Almost all cells have TWO complete set of 23 chromosomes. But two types of human cells have only ONE complete set of chromosomes. These cells are called .haploid.. Haploid cells are made through another type of cell division called meiosis. Meiosis starts with one diploid mother cell. The mother cell copies it.s chromosomes and divides, similar to mitosis.
Next, the two daughter cells divide WITHOUT first copying their chromosomes, producing four haploid cells!
Why would we need haploid cells? Meiosis is used to produce haploid sperm and egg cells.
As we all know, a child is conceived when a sperm cell from the child.s father fuses with the mother.s egg cell. The father's sperm cell brings one set of 23 chromosomes, and the mother.s egg cell contains one set. The resulting cell, now diploid, is called a zygote. Soon the zygote with its two sets of 23 chromosomes begins to divide, ultimately forming a child.
This is how we all start out as a single cell!
The First Step
DNA
Genetics is about the transfer of information among many different levels. The information in DNA is organized into. Genes, in turn, make up Chromosomes, which when taken all together form an organism’s Genome.
Every cell in an Individual contains the genome.
Instructions that provide almost all of the information necessary for a living organism to grow and function are in the nucleus of every cell. These instructions tell the cell what role it will play in your body. The instructions are in the form of a molecule called deoxyribonucleic acid, or DNA. DNA is the chemical responsible for preserving, copying and transmitting information within cells and from generation to generation. The DNA molecule contains genes that direct the production of proteins.
In humans, the DNA molecule consists of two ribbon-like strands that wrap around each other, resembling a twisted ladder. This is often described as a double helix. DNA is contained in tightly coiled packets called chromosomes, found in the nucleus of every cell. Chromosomes
A
A+T
A
C+G
A single strand of DNA is made of letters: ATGCTCGAATAAATGTGAATTTGA
The letters make words: ATG CTC GAA TAA ATG TGA ATT TGA
The words make sentences: <ATG CTC GAA TAA> <ATG TGA ATT TGA>
These "sentences" are called genes. Genes are the basic units of heredity in living cells. Genes tell the cell to make other molecules called proteins. Proteins are required for the structure, function, and regulation of the body’s cells, tissues, and organs. Every protein is made up of a chain of building blocks called amino acids.
The code that is carried by DNA determines which amino acids will come together in what order to form a given protein. Genes act, or "express," themselves by dictating the order of amino acids used to make proteins.
The proteins made by some genes are needed by all cells, but different sets of genes may be switched on or off in different cells. This leads to different collections of proteins being made and results in different structures, appearances and functions. In addition to determining what proteins are made, the DNA in a cell also controls how much of a protein will be made and under what circumstances.
Like father, like son.
With the chemistry bit out of the way, let.s take a look at the more fundamental mechanics of genetics. What do we mean by inheritance? Certainly not something left to us in a will from an elderly relative. Each of us receive traits - in the form of genes - from our parents. The passing of genes from parent to child is the basis of inheritance. If we inherit our parents' genes then why don't we look exactly like them?
Children aren.t identical to their parents because each child receives half of their.s from the mother and the other half from the father. This means each child has some of each parents traits - but not all of them.
Every human being is defined by two complete sets of 23 chromosomes which are the large packages of DNA that contain our genes. When a mother and father conceive a child, each parent contributes exactly one complete set of 23 chromosomes to the child. So how many combinations can these parents contribute to their children? Before you start thinking about it, the answer is not four - inheritance is not that simple.
As I said earlier, each parent contributes one complete set of chromosomes to each child. However, the set can be a mixture of chromosomes from both of the parent.s two sets. The only rule is that the child must receive one of each chromosome.
Dad's two sets of Chromosomes. What Dad might give baby
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 X
1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 Y
As a result, each brother and sister inherits a very different set of chromosomes. From each parent there are 2,238,388,608 - possible combinations. The greyhound has 39 pairs of chromosomes so I'll leave you to work that one out.
How characteristics are inherited
Characteristics can be inherited in many different ways. One characteristic can have many different forms - for example, blood type can be A, B, AB or O. Each of these different forms of a characteristic is caused by variations in the gene for that characteristic. Each variation of a gene is called an allele. Different forms (alleles) of the one gene (one from each parent) can be inherited in different ways.
Dominant and recessive inheritance
Both genes in each set of chromosomes send messages to influence the workings of the cell. Some genes are dominant over others. Dominant inheritance is when one form (allele) of a gene is dominant over its pair. For blood groups, the A allele is dominant over the O allele. So a person with one copy of the A allele and one copy of the O allele has the blood group A, because A is dominant over O. Another way of saying this is that the O group is recessive - a person needs two copies of O to have the blood group O.
A child may have blood group A, for example, because the ’blood group A’ gene inherited from its mother is dominant over the ’blood group O’ gene inherited from its father.
This concept can be explained with the Punnett Square, named after the mathematician and biologist R C Punnett who created a graph to represent inheritance patterns. Below, it.s used to look at blood group inheritance.
Mother AO and father OO
If the mother has an A allele and an O allele, her blood group will be A because the A is dominant. The father has two O alleles (OO), so he has the blood group O. Each one of their children has a 50 per cent chance of having blood group A (AO) and a 50 per cent chance of having blood group O (OO), depending on which alleles they inherit.
The Punnett Square would represent this information in the following way. The paired alleles show the possible variations in the genes of their offspring.
Father
O O
Mother
A
AO AO
O
OO OO
Mother AO and father AA
If the mother has an A allele and an O allele, her blood group will be A because the A is dominant. The father has two A alleles, so his blood group is also A. Their children will be either AO or AA but, either way, each one will have blood group A because the A allele is dominant. The Punnett Square would represent this information in the following way - the paired alleles show the possible variations in the genes of their offspring.
Father
A A
Mother
A
AA AA
O
AO AO
The AO children in the second case above will have a 50 per cent chance of passing on either the A or the O allele to their own offspring. This explains, for example, why parents with blood group A (if
both AO) can produce a child with blood group O. One more bit of terminology before we move on - an animal with matching alleles (AA) for a characteristic is called homozygous. An animal with two different alleles (AO) is called heterozygous.
The Greyhound
So far we.ve talked about human genetics, but what about the greyhound. Even though the principles of genetics are the same for all species, very little research or collection of information has been done on greyhound-specific subjects.
Search the web and you.ll find hundreds of thousands of references for guppy fish, siamese cats and other exotic creatures,but not the greyhound, unless you breed the Italian version.
In 1996, Gavin Fitzpatrick, Keeper of the Australian and New Zealand Greyhound Stud Book , published a report called The Colour and Inheritance of The Greyhound. He describes how he researched the subject in conjunction with geneticists in England and Australia and put forward a .Rule of Thumb. report to the Annual Conference of the Australian and New Zealand Greyhound Association for acceptance, which, in most cases, was accepted and adopted as policy.
In short, he showed the order of dominance in coat colour to be:
Black
Blue
Bridle
Fawn
FAWN TO FAWN - can only produce fawn (the equal) and cannot produce any of the more dominant colours (Brindle, Blue, Black or Dun).
BRINDLE TO BRINDLE - can only produce brindles (the equal) or the colour fawn which is recessive to brindle, and cannot produce the more dominant colours, (Blue, Black or Dun).
BLUE TO BLUE - can only produce blue, (the equal) or the recessive colours of brindles or fawn, and cannot produce the more dominant colour, (Black)
BLACK TO BLACK - can produce black, blue, dun, brindle or fawn all of the last four mentioned being recessive to black.
So, what now?
We all think we can spot greatness. I did the first time I saw Some Picture run. My first thoughts were not how the lucky so-and-so managed to own such a superb animal - I thought about all the mechanisms which arranged all the right genetic combinations into the perfect racing machine. At the other extreme, what about the negative genetic factors that combined together to send a once promising sapling to obscurity, or those that contrive an otherwise disappointing bitch that will join the .also rans. of the breeding ranks.
Picking out a decent dog is one thing, but successfully breeding it, or breeding from it, is another. The variable environmental factors such as rearing, diet and training can make it difficult to assess the genetic combinations of greyhounds. Believe me, there are some bloody awful breeding and rearing establishments out there.
Although environmental factors will help determine whether genetic potential is reached, they will not affect the actual genetic status of a greyhound. Producing a successful dog is made easier if the raw genetic material is present at the outset.
Breeding strategies and trends combined with a perception of a greyhound.s ability, or potential, determine the shape of things to come. If there are as many successful bitches on the track as there are dogs, and given that only 1 per cent of dogs and maybe 50 per cent of the bitches in this book going back into breeding, it would be natural to assume that the breeding industry is missing out on a number of useful male greyhounds or breeding from a majority of mediocre or useless females.
Whilst the former may be true to a lesser extent, support for the latter assumption might be a good deal stronger. There is an obvious imbalance, and choosing the best mating combinations is problematic. But these statements are more relevant when you consider that racing on these shores does not produce an equal amount of successful greyhounds. The fact that this imbalance exists indicates that the selection of sires for breeding is based on success whereas the selection of broods is often based mainly on hope.
Let's catch our breath and have a few statistics to illustrate the point. 2003 and 2004 were vintage years for the girls with the likes of Farloe Verdict, Spell Bound, Ericas Equity etc. but of the five thousand and eighty-five greyhounds listed in last year.s database, 68 per cent are dogs and 32 per cent are bitches. Of the 13,405 races covered, 72 per cent were won by the male of the species. Of those races run up to 579 metres, this increases to 77 per cent. As you would expect, the only time bitches proved dominant was over longer distances winning 54 per cent of races at 580 metres or more.
So does hope only apply to the small breeder? Many broods from the larger establishments are there due to the presence of certain families back in the pedigree. This would suggest that for most breeders, the more reliable source of genetic material comes from the sire. However, the ability of a sire to translate his racing performance into breeding potential is not always guaranteed.
Whilst both parents of a pup contribute equally to genes that are carried on chromosomes, the dam unilaterally contributes DNA via structures called the mitrochondria . This can mean the dam contributes up to 52 per cent of total DNA and the sire only 48 per cent. The mtDNA as it is known is present in different formats in different female families and is transmitted as a unit.
Single, major genes known as monogenes undoubtedly affect a few desirable physical and physiological traits that contribute to performance. Different variants or alleles of these, carried by different dogs, probably contribute to the variation in performance levels. Getting the right integration of complimentary alleles in the same dog is not so simple.
Groups of genes, called polygenes, also work in a cumulative manner to affect a trait Some may work to increase the value of it, and others may work to decrease it. These genetic modifiers do not have a loci of their own, instead they latch on to compatible genes and alter their effect. Polygenes are responsible for the intensity of certain traits and are inherited independently of each other but work collectively. These are less predictable, as groups of genes are not normally inherited en masse. They are sometimes called Quantitative Trait Loci (QTLs). They affect imprecise traits such as growth and stamina.
They are likely to be affected by environmental factors such as diet and training. When you consider everything we.ve learned in the last few paragraphs about genetic interaction, and add the fact that some alleles may be .switched on. or .turned off., depending on which parent the pup received it from, a rough explanation for disparity in performance is provided.
It will be a rare occasion when all of these factors work in symmetry, but to get some of them in harmony would be an achievement. Each dog carries two copies of each regular gene, one from the sire and one from the dam. In an ideal world, a dog receives a high number of duplicated alleles for beneficial traits, whilst avoiding duplications of bad ones. The optimum mating is dependent on the correct gene dynamics between sire and dam.
Which way to go?
The only rule in breeding is that there are no rules. There.s no sure-fire breeding theories out there to help us along the way either. Bruce Lowe had his, so did Weissman, and some breeders put forward rational arguments in support. Another one, Galton.s Theory, argued that the quality of offspring was determined by the number of champions in it's ancestors.
Perhaps it was Galton who coined the phrase 'only breed from the best to get the best'. If it was, he forgot to add the words 'and hope for the best'.
Some leading experts in the horse racing industry believe that between 30-35 per cent of a horse's ability is inherited. The remaining 65-70 per cent of a horse's ability would be attributed to non-inherited factors such as nutrition, training and health care. Not everyone, including me, agree with these ratios. If the ratios were to be reversed I might then concur.
A breeder and trainer can influence ultimate ability through proper rearing and training - that's why the leading breeding establishments, such as the Dunphy brothers operation in Portlaw, regularly churn out winners year after year.
They.re exceptional in the art of rearing, but so to are they in their selection of breeding stock. They do very well with their own, but they also 'buy in'. They don.t just buy anything. They are very selective in this respect and apply the same rules of excellence as they do to rest of their operation.
Environmental factors are very important, but more so are genetics - and you can.t have one without the other. If you could, we.d be using Joe Soap.s dog down the street or buying £200 pups from the local 'pik 'n' mix' breeder and sending them to the Dunphys to rear. We breed dogs for speed to run against other dogs bread for speed. The times Mick The Miller did in the 1930’s would only get him in bottom grade now. Is the difference only down to better nutrition or training techniques? I don't think so.
Many breeders successfully follow the practice of inbreeding and line breeding. Inbreeding is the mating of sire and a dam who carry the same individual within the first three generations. Line breeding takes over as an extension of inbreeding by the reinforcement of desirable ancestors within the fourth, fifth, and sixth generations. Some will look for a 'sex balanced' form of inbreeding (or closely line bred) where the dog who is being inbred to appears through both a son and daughter. One of the uncertainties of this approach is that you are more likely to get the homozygous or the identical copies of a gene. This could be good in a desirable trait, or it could be bad.
Breeding 'like for like' has its devotees: Sprinter to sprinter or stayer to stayer. There's enough evidence in human genetics to suggest some genes, or variants of genes, involved in endurance activities differ from those with a greater influence on power-orientated sports. There are numerous processes, both metabolic and biochemical, going on at any one time in the cells of an individual; Energy release for sprint events or the breaking down of compounds for the endurance events. We also know that the distribution of muscle fibre types differs in sprinters (more fast twitch) and stayers (more slow twitch). Crossing animals from the two groups does seem to result in animals with intermediate fibre distribution. Does this give us a middle distance runner? It might well do, but devotees might refer to the 'jack of all trades, but master of none' adage.
Outcrossing, the opposite of inbreeding, is when the sire and dam have no significant ancestors common in their pedigree - both genetically different. It.s very popular at the moment, and with good reason. Sand Man and Frightful Flash revitalised the gene pool of the modern day greyhound and now with the Australian brigade, headed by Top Honcho, introducing more .hybrid vigour,. breeding greyhounds would appear easy....for now that is. This generation's outcrossing is line breeding in the next.
Population geneticists put forward valid arguments on the virtues of outcrossing. The demise of small island communities with their small gene pools compared to the hybrid vigour brought to America by immigrants during the last century. Outcrossing is probably a sound way to produce greyhounds but it can be hard to predict the results of an individual offspring of a mating - George W. Bush springs to mind. There.s ample evidence of failed imported sires to stop thinking of outcrossing as the 'holy grail'.
Cross Breeding, or nicking, is the mating a sire with a daughter of a particular broodbitch sire; The Lindas Champion/Sand Man cross would be a good example. This type of breeding takes more research, but is rewarded with above average results.
That's just about it, but just one last topic. We can breed for speed or we can breed for endurance, but can we breed for .heart.. Not that large muscle behind the rib-cage, though it would be nice to have a large one, but that intangible competitive spirit and deep-seated desire to win that separates champions from the also-rans. Even those graders who win more than their fair share could also be put into this category. So is 'heart' inheritable?
The fact that we breed greyhounds to chase suggests that in some way it is but environmental factors must come into the equation. So repeating myself; Although environmental factors will help determine whether genetic potential is reached, they will not affect the actual genetic status of a greyhound. Producing a successful dog is made easier if the raw genetic material is present at the outset.
© Curve Web Solutions 2004. All rights reserved.
Shades Of Soul Ace Hi Rumble x Make A Wish 
Bling Bling Flo Honcho Classic x Grayslands Flo 
Lady Glenard Head Bound x You Said So 
Another Issue Black Shaw x Dromana Flower
Maireads Fantasy Premier Fantasy x Maybe Baby
Skywalker Queen Razlydazl Billy x Nifty Princess